Review




Structured Review

Merck & Co bugbuster ht protein extraction reagent
Bugbuster Ht Protein Extraction Reagent, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bugbuster+protein+extraction+reagent/bugbuster+extraction+protein+reagent/bio_rxiv__64898__2026__03__26__714365-37-0-15
Average 86 stars, based on 1 article reviews
bugbuster ht protein extraction reagent - by Bioz Stars, 2026-10
86/100 stars

Images

Related Articles

Protein Extraction:

Article Title: Towards a comprehensive chemical and genetic tool library for rhamnogalacturonan-II oligosaccharides and exploitation
Article Snippet: .. Cell were later resuspended in buffer containing 20 mm Tris/HCl, pH 8.0, plus 100 mm NaCl (Talon) and disrupted by addition of Bugbuster protein extraction reagent (Merck) for 20 mins at room temperature. .. Released recombinant proteins were purified from the supernantant cell-free extract by immobilized metal affinity chromatography (IMAC) using TalonTM gel resins (Clontech) a described in Ndeh et al . For CE8 enzymes, initial cloning was performed using infusion (Takara Bio) protocol and the following primers; CE8F: gtcgcggatccgaattcgagctcgataacaaattgacattaaccgttgctca CE8R: ccgcaagcttgtcgacggagctcttatttggccggattccatccattc

Article Title: Concurrent Linear Deracemization of Secondary Benzylic Alcohols via Simultaneous Photocatalysis and Whole-cell Biocatalysis
Article Snippet: .. The pellets were collected by centrifugation then resuspended in BugBuster® Protein Extraction Reagent (Merck) according to manufacturer instructions, normalizing the volume by OD600 values. .. Plasmid name Description Reference pET-22b(+) pET-22b(+) vector (pBR322/Rop oriV, AmpR, lacI, T7 IPTG induction, pelB signal) Novagen pADH-RrADHA pET-22b(+) vector, RBS1, CDS of Rhodococcus ruber alcohol dehydrogenase A (RrADHA) with C-terminal 6×His tag fusion, pelB signal deletion This work pADH-GcAPRD pET-22b(+) vector, RBS1, CDS of Geotrichum candidum acetophenone reductase (GcAPRD) with C-terminal 6×His tag fusion, pelB signal deletion This work pADH-LkADH pET-22b(+) vector, RBS1, CDS of Lactobacillus kefir alcohol dehydrogenase (LkADH) with C-terminal 6×His tag fusion, pelB signal deletion This work pADH-KtCR pET-22b(+) vector, RBS1, CDS of Kluyveromyces thermotolerans carbonyl reductase (KtCR) with C-terminal 6×His tag fusion, pelB signal deletion This work pADH-EbSDR8 pET-22b(+) vector, RBS1, CDS of Empedobacter brevis short chain dehydrogenase/reductase (EbSDR8) with C-terminal 6×His tag fusion, pelB signal deletion This work pADH-LxCAR- S154Y pET-22b(+) vector, RBS1, CDS of Leifsonia xyli carbonyl reductase (LxCAR, S154Y mutant) with C-terminal 6×His tag fusion, pelB signal deletion This work Table S2.

Article Title: Concurrent Linear Deracemization of Secondary Benzylic Alcohols via Simultaneous Photocatalysis and Whole-cell Biocatalysis
Article Snippet: .. Lyophilized E. coli WCBs were lysed with BugBuster® Protein Extraction Reagent (Merck), the soluble fractions were denatured and reduced with NuPAGE LDS sample buffer (Thermo Fisher Scientific) and DTT at 95°C for 10 min, then separated on a 4–20% Mini-PROTEAN TGX Stain-Free protein gel (Bio-Rad) in 1X TGS buffer. ..

Article Title: De Novo Design of Ultrahigh-Affinity Miniproteins Targeting PD-L1 for Non-Invasive Imaging: Preclinical Validation and First-in-Human Study
Article Snippet: .. The cells were harvested by spinning at 4,000 × g for 10 min and then resuspended in BugBuster® Protein Extraction Reagent (Merck) with DNase (Millipore) and protease inhibitor tablets (Merck). .. The cells were lysed with a Qsonica Sonicators sonicator for a total of 4 minutes (2 minutes on time, 10 sec on, 10 sec off) with an amplitude of 80%.

Article Title: Unique bifunctional α-sialidase/β- N -acetylgalactosaminidase from Bifidobacterium bifidum acting on the Sd a antigen
Article Snippet: .. Cells were lysed by BugBuster Protein Extraction Reagent (Merck). .. After centrifugation, the supernatant was applied to a His GraviTrap (1 ml, GE Healthcare), and the adsorbed proteins were eluted using a stepwise imidazole concentration gradient in 50 mM sodium acetate buffer (pH 5.5) containing 250 mM NaCl.

Article Title: Control of the archaeal DNA damage-responsive pathway by phosphorylation of Orc1-2, the global regulator in Saccharolobus islandicus.
Article Snippet: .. Cell pellets were resuspended with the Bugbuster protein extraction reagent (Merck) by gentle pipetting, followed by incubation at room temperature for 15 min. ..

Article Title: Control of the archaeal DNA damage-responsive pathway by phosphorylation of Orc1-2, the global regulator in Saccharolobus islandicus
Article Snippet: .. Cell pellets were resuspended with the Bugbuster protein extraction reagent (Merck) by gentle pipetting, followed by incubation at room temperature for 15 min. ..

Article Title: Heterologous Production and Characterization of Rapeseed Procruciferin Isoforms for Sustainable Food Protein Development
Article Snippet: .. To assess protein production, cells from 2 mL of culture were pelleted (9660 × g, 5 min, room temperature, RT), lysed by 400 μL BugBuster protein extraction reagent (Merck) supplemented with 250 mM NaCl (40 min, RT, shaking 950 rpm) and centrifuged (9660 × g, 10 min, RT). ..

Centrifugation:

Article Title: Concurrent Linear Deracemization of Secondary Benzylic Alcohols via Simultaneous Photocatalysis and Whole-cell Biocatalysis
Article Snippet: .. The pellets were collected by centrifugation then resuspended in BugBuster® Protein Extraction Reagent (Merck) according to manufacturer instructions, normalizing the volume by OD600 values. .. Plasmid name Description Reference pET-22b(+) pET-22b(+) vector (pBR322/Rop oriV, AmpR, lacI, T7 IPTG induction, pelB signal) Novagen pADH-RrADHA pET-22b(+) vector, RBS1, CDS of Rhodococcus ruber alcohol dehydrogenase A (RrADHA) with C-terminal 6×His tag fusion, pelB signal deletion This work pADH-GcAPRD pET-22b(+) vector, RBS1, CDS of Geotrichum candidum acetophenone reductase (GcAPRD) with C-terminal 6×His tag fusion, pelB signal deletion This work pADH-LkADH pET-22b(+) vector, RBS1, CDS of Lactobacillus kefir alcohol dehydrogenase (LkADH) with C-terminal 6×His tag fusion, pelB signal deletion This work pADH-KtCR pET-22b(+) vector, RBS1, CDS of Kluyveromyces thermotolerans carbonyl reductase (KtCR) with C-terminal 6×His tag fusion, pelB signal deletion This work pADH-EbSDR8 pET-22b(+) vector, RBS1, CDS of Empedobacter brevis short chain dehydrogenase/reductase (EbSDR8) with C-terminal 6×His tag fusion, pelB signal deletion This work pADH-LxCAR- S154Y pET-22b(+) vector, RBS1, CDS of Leifsonia xyli carbonyl reductase (LxCAR, S154Y mutant) with C-terminal 6×His tag fusion, pelB signal deletion This work Table S2.

Staining:

Article Title: Concurrent Linear Deracemization of Secondary Benzylic Alcohols via Simultaneous Photocatalysis and Whole-cell Biocatalysis
Article Snippet: .. Lyophilized E. coli WCBs were lysed with BugBuster® Protein Extraction Reagent (Merck), the soluble fractions were denatured and reduced with NuPAGE LDS sample buffer (Thermo Fisher Scientific) and DTT at 95°C for 10 min, then separated on a 4–20% Mini-PROTEAN TGX Stain-Free protein gel (Bio-Rad) in 1X TGS buffer. ..

Protease Inhibitor:

Article Title: De Novo Design of Ultrahigh-Affinity Miniproteins Targeting PD-L1 for Non-Invasive Imaging: Preclinical Validation and First-in-Human Study
Article Snippet: .. The cells were harvested by spinning at 4,000 × g for 10 min and then resuspended in BugBuster® Protein Extraction Reagent (Merck) with DNase (Millipore) and protease inhibitor tablets (Merck). .. The cells were lysed with a Qsonica Sonicators sonicator for a total of 4 minutes (2 minutes on time, 10 sec on, 10 sec off) with an amplitude of 80%.

Gentle:

Article Title: Control of the archaeal DNA damage-responsive pathway by phosphorylation of Orc1-2, the global regulator in Saccharolobus islandicus.
Article Snippet: .. Cell pellets were resuspended with the Bugbuster protein extraction reagent (Merck) by gentle pipetting, followed by incubation at room temperature for 15 min. ..

Article Title: Control of the archaeal DNA damage-responsive pathway by phosphorylation of Orc1-2, the global regulator in Saccharolobus islandicus
Article Snippet: .. Cell pellets were resuspended with the Bugbuster protein extraction reagent (Merck) by gentle pipetting, followed by incubation at room temperature for 15 min. ..

Incubation:

Article Title: Control of the archaeal DNA damage-responsive pathway by phosphorylation of Orc1-2, the global regulator in Saccharolobus islandicus.
Article Snippet: .. Cell pellets were resuspended with the Bugbuster protein extraction reagent (Merck) by gentle pipetting, followed by incubation at room temperature for 15 min. ..

Article Title: Control of the archaeal DNA damage-responsive pathway by phosphorylation of Orc1-2, the global regulator in Saccharolobus islandicus
Article Snippet: .. Cell pellets were resuspended with the Bugbuster protein extraction reagent (Merck) by gentle pipetting, followed by incubation at room temperature for 15 min. ..



Similar Products

86
Merck & Co bugbuster ht protein extraction reagent
Bugbuster Ht Protein Extraction Reagent, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bugbuster+protein+extraction+reagent/bugbuster+extraction+protein+reagent/bio_rxiv__64898__2026__03__26__714365-37-0-15
Average 86 stars, based on 1 article reviews
bugbuster ht protein extraction reagent - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

86
Merck & Co bugbuster protein extraction reagent
Bugbuster Protein Extraction Reagent, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bugbuster+protein+extraction+reagent/bugbuster+extraction+protein+reagent/bio_rxiv__64898__2026__03__13__711244-325-22-26
Average 86 stars, based on 1 article reviews
bugbuster protein extraction reagent - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

90
Millipore bugbuster protein extraction reagent cat. no. 70584-3
Bugbuster Protein Extraction Reagent Cat. No. 70584 3, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bugbuster+protein+extraction+reagent/bugbuster+protein+extraction+reagent/pmc12267110-340-8-12
Average 90 stars, based on 1 article reviews
bugbuster protein extraction reagent cat. no. 70584-3 - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results